;91 Circular sequences are stored in the computer as linear sequences that may start and at any position along the sequence. When the last base is used, the programs next switch to the first base in a circular fashion. This program allows the user to specify which base is the first one in the stored sequence. A common reason for doing this would be to make the sequence break at a restriction sites that is to be sued for cloning. It is then simple to join the sequence to another with similar ends and thereby to simulate a cloning reaction. The new file has a line of information at the top after a > sign (to indicate that the line is a comment) showing the disk file used to create it. example: input sequence 5'-ttcatatatatatcgcgcgcgcgatatatatatagaa2-3' output sequence 5'-aattcatatatatatcgcgcgcgcgatatatatatag2-3' output sequence aattc......g can be joined to aattc.....g ;92 This option allows the entry of a short sequence (up to about 25 letters) into a disk file for subsequent analysis. If this is a DNA sequence, the characters A,G,C,T, U (T),P (A/G), Y (C/T),W (A/T),S (G/C), M (A/C),K (G/T),H (not G),B (not A),V (not T),D (not C),N(any base),+(any base or no base),-(any base) may be used. If this is a peptide sequence, then you can E  G++TTC. The sequence must then be loaded into memory for analysis. At that time, the sequence letters will be checked for accuracy. The file will be marked by a comment line at the top. ;93 Hitting the M key followed by return or by just hitting return control passes back to the main menu of options for the programs. ;94 The number requested is the minimum overlap or minimum internal length of homology between 2 sequences that should be reported. The longer the length, the more alike the sequences must be. Hitting the return uses a value of 10. Note that only the first such common length of sequence will be reported. example: An entry of 10 will report the homology shown below because it is at least 10 in length. input sequence 1 atatatatatcgcgcgcgcgatatatatata input sequence 2 ggggggggggcgcgcgcgcgatatatatata the overlap reported is cgcgcgcgcgatatatatata ;95 This prompt is for the name of a disk file to receive a length of sequence just identified. Enter a name such as test.seq and then hit return. Just hitting return takes you back to the last menu of options. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name which will destroy the contents of any file that exists with this same name. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name. ;96 Enter a number to indicate the first residue in the new sequence then a space then a second number representing the last residue in the new sequence, then hit return to enter the values. If the first number is smaller than the second, then the same sequence as the original will appear, if the first number is smaller, then it will be taken to mean that you want to use the complementary sequence in the opposite direction to the original sequence. ;97 This prompt is for the name of a disk file to receive a length of sequence left over after the deletion has been made. Enter the name of a sequence such as test.seq and hit return. Hitting just return takes you back to the last menu of options. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name. ;98 Enter a number to indicate the first residue in the sequence to be deleted then a space then a second number representing the last residue to be deleted, then hit return to enter the values. ;99 This prompt is for the name of a disk file to receive a the combined sequences just identified. Enter the name of a sequence such as test.seq and hit return. Hitting just return takes you back to the last menu of options. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name. ;100 This prompt is for the name of a disk file to receive a the complementary DNA sequence. Enter the name of a sequence such as test.seq and hit return. Hitting just return takes you back to the last menu of options. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name. ;101 This prompt is for the name of a disk file to receive the sequence with the circular designation. Enter the name of a sequence such as test.seq and hit return. Hitting just return takes you back to the last menu of options. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name. ;102 This prompt is for the name of a disk file to receive the rearranged sequence generated by this program. Enter the name of a sequence such as test.seq and hit return. Hitting just return takes you back to the last menu of options. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name. ;103 This prompt is for the name of a disk file to receive a sequence that you will then be able to type into the disk file. Enter the name of a sequence such as test.seq and hit return. Hitting just return takes you back to the last menu of options. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name. ;104 This prompt is asking you whether or not you want to have the opportunity to save lengths of DNA sequence between restriction sites in disk files. If you answer Y followed by return then you will be asked after each fragment is displayed if you want to save this DNA sequence in a disk file. Hitting any other key then return or just return by itself will lead to the program not asking this question after each fragment. We recommend that only use this if you are searching for sites cut by 1 or 2 enzymes. Otherwise there could be a very large number of interruptions by prompts. The program is designed to enable you to save sequence fragments in a way that simulates their recovery from enzymatic digestion and gel recovery of the fragments. ;105 If you answer Y followed by return then you will be asked to enter the name for a disk file for saving the fragment while its end points are known. Hitting any other key then return or just return by itself will lead to the program going on to the next fragment or enzyme. The program is designed to enable you to save sequence fragments in a way that simulates their recovery from enzymatic digestion and gel recovery of the fragments. ;106 This prompt is for the name of a disk file to receive the restriction fragment just found. Enter the name of a sequence such as test.seq and hit return. Hitting just return takes you back to the last menu of options. If a disk file with the same name already exists, you will be able to chose between overwriting the old file and thereby destroying its contents and entering another name. ;107 A response of hitting C followed by return or of just hitting C will mark the sequence file as being circular, such as for a circular plasmid or phage DNA. Hitting L or any other key followed by return will mark the sequence file as being linear. ;108 By analyzing the letters in the patterns and target sequences that have been used, the program has detected that the pattern has characters other than A, G, C and T. We are checking with you to make sure that you intend the pattern to be amino acids also and that haven't made an error. However, the target sequence is a protein sequence composed of amino acids letters. You must hit a Y followed by return to continue the analysis, and to use the pattern as amino acids, not as having ambiguous DNA bases in it. ;109 This program takes as input an entire single letter code amino acid sequence from a previously prepared disk file and predicts the molecular weight of the entire sequence by adding up the molecular weights of the individual residues minus water molecules. A similar type of analysis is done to predict pK' for the protein. Amino acid sequences calculated by these programs can have a Z in them which represents the position of a termination codon in the sequence. If a Z is encountered by the program, the analysis stops at that point. ;110 This program will find AT-rich and GC-rich regions in a DNA sequence. The user specifies a sequence length or window length for averaging such as 100. The program then moves down the sequence and scores the first 100 bases, numbered 1-100 and records the sequence interval (1-100 in this case), %AT, %GC and AT/GC ratio in the interval. It then returns to the second base and scores 2-101 in the same fashion. The resulting table displays any shift in the AT/GC content of the sequence. ;111 Enter a number and then hit return - hitting return uses the number in square brackets. If the window length 100, the program then moves down the sequence and scores the first 100 bases and records the sequence interval (1-100 in this case), and %AT, %GC and AT/GC ratio in the interval. ;145 If a response of N followed by return is given, then the program will ask you for another filename and the contents of the old file will not be destroyed. Hitting any other key and then return, or just return by itself will lead to an overwrite of the old file, destroying its contents. ;112 Enter a P followed by return or just a return if this is a peptide, and N followed by return if this is a nucleic acid sequence. The sequence file will be marked and interpreted accordingly. ;113 If the listing in the table indicates that help will be offered, then questions about help will appear as the programs are running - otherwise they˙will not. ;114 not used ;115 not used ;116 not used ;117 In a coding region of a DNA sequence, there is frequently a correlation between bases 1 and 2 in a codon, and between bases 2 and 3, but not between base 3 and base 1 of the next codon. If the analysis is starting at the first base in codon, therefore, you may not wish to take into account every 3rd dinucleotide. If you answer by hitting N then return, or by just hitting return, all dinucleotides will be scored. A response of Y followed by return will lead to a skipping of every 3rd pair in the analysis. ;118 The reason that you are having trouble starting the program is that all sequences and patterns to be used are loaded into the computer memory to make the analysis faster, and you don't have enough memory with the program set up as it is now. However, you can adjust the program to fit your system. Memory is set aside for these sequence and pattern storage information as the program starts. The amount of memory needed depends upon the total length of the sequences to be analyzed and upon the number of sequence patterns to be searched for simultaneously. You specify how much memory to set aside for these purposes by modifying a 2 line file called sequence.dat with your text editor. This file has 2 numbers in it. The number on the first line tells how long the sequences are. A typical number is 50000. Thus, 50000 bytes of memory are set aside for storing sequences. In addition, the program sets aside another 1.8 times this number of bytes for storing information on positions of pattern matches, and of met and termination codons. The second line in file sequence.dat tells how much memory to be used for pattern searching. We can search for up to 150 patterns, each 25 long and need about 1/2 this number of bytes for storing the patterns in a search tree. Thus, the second line of sequence.dat line should be no more than 2000, but can be proportionately smaller if searching for fewer patterns at a time. In addition, pattern searching requires another 9 times this number of bytes for running the search procedure. Thus, the total number of bytes needed for pattern searching is 10 times the second no. entered in file sequence.dat. SUMMARY OF MEMORY REQUIREMENTS 1. basic program called DM5 - needs 97000 bytes of memory 2. sequence storage and information - needs 2.8 times the first number in file sequence.dat in bytes 3. pattern searching - needs 10 times the second no. in file sequence.dat in bytes EXAMPLE OF ENTREES IN FILE SEQUENCE.DAT: 50000 in line 1, 2000 in line 2 memory needed is 97000+140000+20000=257000 this should be enough to look in phage lambda for 150 different restriction endonuclease cleavage sites GOOD LUCK !